| Detail of EST/Unigene CA922746 |
| Acc. | CA922746 |
| Internal Acc. | EST640464 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | RING finger protein 141 OS=Rattus norvegicus E-value=2e-07; RING finger protein 141 OS=Pongo abelii E-value=2e-07; RING finger protein 141 OS=Mus musculus E-value=2e-07; RING finger protein 141 OS=Homo sapiens E-value=2e-07; RING finger protein 141 OS=Gallus gallus E-value=2e-07; |
| Length | 760 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTUS_MIXTISSUE; |
| Sequence | GGAGTGAAGGTGATTTTTTAAATTAAGTTGTTGGTAAAGTTGACATTCAATATTCCATCC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K04707 E3 ubiquitin-protein ligase CBL; Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04707 E3 ubiquitin-protein ligase CBL; Environmental Information Processing > Signal Transduction > ko04630 Jak-STAT signaling pathway > K04707 E3 ubiquitin-protein ligase CBL |
| EC | 6.3.2.19 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 835995 |
| Trichome-related Gene from Literature | N/A |