| Detail of EST/Unigene CA922978 |
| Acc. | CA922978 |
| Internal Acc. | EST640696 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Licodione synthase OS=Glycyrrhiza echinata E-value=2e-59; 2-hydroxyisoflavanone synthase OS=Glycine max E-value=4e-40; Cytochrome P450 93A1 OS=Glycine max E-value=1e-29; Cytochrome P450 93A2 OS=Glycine max E-value=2e-27; Cytochrome P450 93A3 OS=Glycine max E-value=3e-27; |
| Length | 613 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTUS_MIXTISSUE; |
| Sequence | ATGAAAAAGACAGAATTACAAATTTCTTTTACCAACTAAACATGAACATAAAATGTTCGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00512 cytochrome P450, family 17, subfamily A (steroid 17alpha-monooxygenase); ; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07422 cytochrome P450, family 2, subfamily U |
| EC | 1.14.99.9 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 819166 |
| Trichome-related Gene from Literature | N/A |