Detail of EST/Unigene CA923094 |
Acc. | CA923094 |
Internal Acc. | EST640812 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | ATP synthase subunit c, chloroplastic OS=Zygnema circumcarinatum E-value=9e-10; ATP synthase subunit c, chloroplastic OS=Triticum aestivum E-value=9e-10; ATP synthase subunit c, chloroplastic OS=Welwitschia mirabilis E-value=9e-10; ATP synthase subunit c, chloroplastic OS=Vitis vinifera E-value=9e-10; ATP synthase subunit c, chloroplastic OS=Trachelium caeruleum E-value=9e-10; |
Length | 359 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTUS_MIXTISSUE; |
Sequence | TAGATACTAGTTCTTATGTCAATTGCAAAATATCTAGTTGTTTTCAATTCTAAATTAAAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |