| Detail of EST/Unigene CA990983 |
| Acc. | CA990983 |
| Internal Acc. | EST644491 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Beta-1,3-galactosyltransferase 7 OS=Arabidopsis thaliana E-value=2e-34; Probable beta-1,3-galactosyltransferase 8 OS=Arabidopsis thaliana E-value=1e-33; Probable beta-1,3-galactosyltransferase 6 OS=Arabidopsis thaliana E-value=4e-33; Probable beta-1,3-galactosyltransferase 2 OS=Arabidopsis thaliana E-value=2e-32; Probable beta-1,3-galactosyltransferase 3 OS=Arabidopsis thaliana E-value=2e-31; |
| Length | 444 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GESD (1 ESTs); |
| Sequence | GCAATTGGCCAATATTGCACAGATATGCAAATGAAGATGTGTCTCTAGGAGCATGGTTAT |
| EST members of Unigene | CA990983 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.29170.1.S1_at
|
| Corresponding NCBI Gene | 844443 |
| Trichome-related Gene from Literature | N/A |