| Detail of EST/Unigene CB065436 |
| Acc. | CB065436 |
| Internal Acc. | EST645117 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Serine/threonine-protein kinase AtPK2/AtPK19 OS=Arabidopsis thaliana E-value=3e-58; Serine/threonine-protein kinase AtPK1/AtPK6 OS=Arabidopsis thaliana E-value=2e-57; Ribosomal protein S6 kinase beta-1 OS=Bos taurus E-value=9e-31; Ribosomal protein S6 kinase beta-1 OS=Rattus norvegicus E-value=2e-30; Ribosomal protein S6 kinase beta-1 OS=Oryctolagus cuniculus E-value=2e-30; |
| Length | 749 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_HOGA; |
| Sequence | ATAAATAATGCAATTTATTTTCTCCAAACACAAGTTCTAGCAAAGTCAGCTCAACAATTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04688 p70 ribosomal S6 kinase; Environmental Information Processing > Signal Transduction > ko04150 mTOR signaling pathway > K04688 p70 ribosomal S6 kinase; Environmental Information Processing > Signal Transduction > ko04350 TGF-beta signaling pathway > K04688 p70 ribosomal S6 kinase |
| EC | 2.7.11.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820019 |
| Trichome-related Gene from Literature | N/A |