Detail of EST/Unigene CB065517 |
Acc. | CB065517 |
Internal Acc. | EST645198 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase OS=Vitis vinifera E-value=2e-25; Glucan endo-1,3-beta-glucosidase, acidic isoform OS=Zea mays E-value=3e-25; Glucan endo-1,3-beta-glucosidase GI OS=Hordeum vulgare E-value=5e-23; Glucan endo-1,3-beta-glucosidase, acidic isoform GL161 OS=Nicotiana tabacum E-value=4e-22; Glucan endo-1,3-beta-glucosidase, acidic isoform PR-N (Fragment) OS=Nicotiana tabacum E-value=6e-22; |
Length | 466 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_HOGA; |
Sequence | GAACCCGATAAAATATTTTACTTATATATAGAAGAGGATTTCCCTTTTCTTCGATTTCCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824891 |
Trichome-related Gene from Literature | N/A |