| Detail of EST/Unigene CB892013 |
| Acc. | CB892013 |
| Internal Acc. | EST648982 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Phosphoinositide phospholipase C 7 OS=Arabidopsis thaliana E-value=7e-23; Phosphoinositide phospholipase C 2 OS=Arabidopsis thaliana E-value=3e-22; Phosphoinositide phospholipase C 5 OS=Arabidopsis thaliana E-value=9e-21; Phosphoinositide phospholipase C 6 OS=Arabidopsis thaliana E-value=1e-20; Phosphoinositide phospholipase C 4 OS=Arabidopsis thaliana E-value=2e-15; |
| Length | 188 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SEEDROOT_KV3 (1 ESTs); |
| Sequence | TAAGGGTAATTGAGTTGGACTTATGGCCTAATGCATCCAAGGATAATGTTGATGTTCTTC |
| EST members of Unigene | CB892013 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00562 Inositol phosphate metabolism > K05859 phospholipase C, gamma; Environmental Information Processing > Signal Transduction > ko04020 Calcium signaling pathway > K05859 phospholipase C, gamma; Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K05859 phospholipase C, gamma; Environmental Information Processing > Signal Transduction > ko04070 Phosphatidylinositol signaling system > K05859 phospholipase C, gamma; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K05859 phospholipase C, gamma |
| EC | 3.1.4.11 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.29239.1.S1_at
|
| Corresponding NCBI Gene | 824760 |
| Trichome-related Gene from Literature | N/A |