| Detail of EST/Unigene CB892176 |
| Acc. | CB892176 |
| Internal Acc. | EST649145 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Malate dehydrogenase, mitochondrial OS=Citrullus lanatus E-value=1e-59; Malate dehydrogenase, mitochondrial OS=Fragaria ananassa E-value=4e-57; Malate dehydrogenase, mitochondrial OS=Eucalyptus gunnii E-value=2e-56; Malate dehydrogenase 2, mitochondrial OS=Arabidopsis thaliana E-value=2e-56; Malate dehydrogenase, mitochondrial OS=Brassica napus E-value=8e-55; |
| Length | 615 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SEEDROOT_KV3 (1 ESTs); |
| Sequence | AGGGCAGCTTAAAGGTTTGACATCTTAATTTTGCTGCTGAGGAATGTTGTAATTGCATTT |
| EST members of Unigene | CB892176 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00020 Citrate cycle (TCA cycle) > K00026 malate dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00630 Glyoxylate and dicarboxylate metabolism > K00026 malate dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00026 malate dehydrogenase; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K00026 malate dehydrogenase; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K00026 malate dehydrogenase |
| EC | 1.1.1.37 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.29250.1.S1_s_at
|
| Corresponding NCBI Gene | 820731 |
| Trichome-related Gene from Literature | N/A |