| Detail of EST/Unigene CB892618 |
| Acc. | CB892618 |
| Internal Acc. | EST645410 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 6-phosphofructokinase 3 OS=Arabidopsis thaliana E-value=0; 6-phosphofructokinase 6 OS=Arabidopsis thaliana E-value=0; 6-phosphofructokinase 1 OS=Arabidopsis thaliana E-value=0; 6-phosphofructokinase 7 OS=Arabidopsis thaliana E-value=0; 6-phosphofructokinase 4, chloroplastic OS=Arabidopsis thaliana E-value=0; |
| Length | 808 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_HOGA; |
| Sequence | ATAAGCGTGGAGGAACGATTCTTGGGACATCCCGAGGGGGGCATGATACTGGCAAGATAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00051 Fructose and mannose metabolism > K00850 6-phosphofructokinase; Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K00850 6-phosphofructokinase; Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00850 6-phosphofructokinase; Metabolism > Carbohydrate Metabolism > ko00030 Pentose phosphate pathway > K00850 6-phosphofructokinase |
| EC | 2.7.1.11 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828733 |
| Trichome-related Gene from Literature | N/A |