Detail of EST/Unigene CB892618 |
Acc. | CB892618 |
Internal Acc. | EST645410 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 6-phosphofructokinase 3 OS=Arabidopsis thaliana E-value=0; 6-phosphofructokinase 6 OS=Arabidopsis thaliana E-value=0; 6-phosphofructokinase 1 OS=Arabidopsis thaliana E-value=0; 6-phosphofructokinase 7 OS=Arabidopsis thaliana E-value=0; 6-phosphofructokinase 4, chloroplastic OS=Arabidopsis thaliana E-value=0; |
Length | 808 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_HOGA; |
Sequence | ATAAGCGTGGAGGAACGATTCTTGGGACATCCCGAGGGGGGCATGATACTGGCAAGATAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00051 Fructose and mannose metabolism > K00850 6-phosphofructokinase; Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K00850 6-phosphofructokinase; Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00850 6-phosphofructokinase; Metabolism > Carbohydrate Metabolism > ko00030 Pentose phosphate pathway > K00850 6-phosphofructokinase |
EC | 2.7.1.11 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828733 |
Trichome-related Gene from Literature | N/A |