| Detail of EST/Unigene CB892853 |
| Acc. | CB892853 |
| Internal Acc. | EST645645 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Acetate/butyrate--CoA ligase AAE7, peroxisomal OS=Arabidopsis thaliana E-value=0; Probable acyl-activating enzyme 2 OS=Arabidopsis thaliana E-value=1e-70; Probable acyl-activating enzyme 1, peroxisomal OS=Arabidopsis thaliana E-value=6e-69; Benzoate--CoA ligase, peroxisomal OS=Arabidopsis thaliana E-value=8e-66; Butyrate--CoA ligase AAE11, peroxisomal OS=Arabidopsis thaliana E-value=1e-63; |
| Length | 833 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_HOGA; |
| Sequence | ATAGACGACCTTCCAAAGAACGCGGCAAACTACACATCCTTAACACCTTTATGGTTCTTA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 6.2.1.- 6.2.1.3 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820946 |
| Trichome-related Gene from Literature | N/A |