Detail of EST/Unigene CB892853 |
Acc. | CB892853 |
Internal Acc. | EST645645 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Acetate/butyrate--CoA ligase AAE7, peroxisomal OS=Arabidopsis thaliana E-value=0; Probable acyl-activating enzyme 2 OS=Arabidopsis thaliana E-value=1e-70; Probable acyl-activating enzyme 1, peroxisomal OS=Arabidopsis thaliana E-value=6e-69; Benzoate--CoA ligase, peroxisomal OS=Arabidopsis thaliana E-value=8e-66; Butyrate--CoA ligase AAE11, peroxisomal OS=Arabidopsis thaliana E-value=1e-63; |
Length | 833 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_HOGA; |
Sequence | ATAGACGACCTTCCAAAGAACGCGGCAAACTACACATCCTTAACACCTTTATGGTTCTTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 6.2.1.- 6.2.1.3 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820946 |
Trichome-related Gene from Literature | N/A |