Detail of EST/Unigene CB893342 |
Acc. | CB893342 |
Internal Acc. | EST646134 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-glucosidase 11 OS=Arabidopsis thaliana E-value=0; Beta-glucosidase 4 OS=Arabidopsis thaliana E-value=0; Beta-glucosidase 3 OS=Arabidopsis thaliana E-value=0; Hydroxyisourate hydrolase OS=Glycine max E-value=2e-99; Beta-glucosidase 10 OS=Arabidopsis thaliana E-value=9e-99; |
Length | 821 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_HOGA; |
Sequence | AGGAAGGCAAGCATATGGGATACCTTTGCACATGCTGGCAATGGAGGGCTATACAAGGGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
EC | 3.2.1.21 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839435 |
Trichome-related Gene from Literature | N/A |