| Detail of EST/Unigene CB893377 |
| Acc. | CB893377 |
| Internal Acc. | EST646169 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Pheophorbide a oxygenase, chloroplastic OS=Arabidopsis thaliana E-value=3e-35; Protochlorophyllide-dependent translocon component 52, chloroplastic OS=Arabidopsis thaliana E-value=7e-23; Protein TIC 55, chloroplastic OS=Pisum sativum E-value=3e-13; Protein TIC 55, chloroplastic OS=Arabidopsis thaliana E-value=5e-12; Chlorophyllide a oxygenase, chloroplastic OS=Dunaliella salina E-value=2e-10; |
| Length | 256 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_HOGA; |
| Sequence | GTTCTTCATCGAAGTTTTCATGGAGAGATCATTGGTACCCAGTTTCTTTGATTGAAGATC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | 3.A.9 Chloroplast protein translocating system (Tic-Toc) CEPT |
| Probeset |
|
| Corresponding NCBI Gene | 823622 |
| Trichome-related Gene from Literature | N/A |