Detail of EST/Unigene CB893377 |
Acc. | CB893377 |
Internal Acc. | EST646169 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Pheophorbide a oxygenase, chloroplastic OS=Arabidopsis thaliana E-value=3e-35; Protochlorophyllide-dependent translocon component 52, chloroplastic OS=Arabidopsis thaliana E-value=7e-23; Protein TIC 55, chloroplastic OS=Pisum sativum E-value=3e-13; Protein TIC 55, chloroplastic OS=Arabidopsis thaliana E-value=5e-12; Chlorophyllide a oxygenase, chloroplastic OS=Dunaliella salina E-value=2e-10; |
Length | 256 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_HOGA; |
Sequence | GTTCTTCATCGAAGTTTTCATGGAGAGATCATTGGTACCCAGTTTCTTTGATTGAAGATC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | 3.A.9 Chloroplast protein translocating system (Tic-Toc) CEPT |
Probeset |
|
Corresponding NCBI Gene | 823622 |
Trichome-related Gene from Literature | N/A |