| Detail of EST/Unigene CB893431 |
| Acc. | CB893431 |
| Internal Acc. | EST646223 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Dihydropyrimidinase OS=Dictyostelium discoideum E-value=6e-84; D-hydantoinase/dihydropyrimidinase OS=Pseudomonas aeruginosa (strain ATCC 15692 / PAO1 / 1C / PRS 101 / LMG 12228) E-value=1e-79; D-hydantoinase/dihydropyrimidinase OS=Pseudomonas putida E-value=5e-78; Dihydropyrimidinase OS=Homo sapiens E-value=2e-76; Dihydropyrimidinase OS=Mus musculus E-value=4e-76; |
| Length | 853 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_HOGA; |
| Sequence | TTTTCACAGATATGGAGATCATGGTTAAGGAGAAAGGTATCAACTCTTTCAAGTTTTTCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K01464 dihydropyrimidinase; Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K01464 dihydropyrimidinase; Metabolism > Metabolism of Other Amino Acids > ko00410 beta-Alanine metabolism > K01464 dihydropyrimidinase; Metabolism > Metabolism of Cofactors and Vitamins > ko00770 Pantothenate and CoA biosynthesis > K01464 dihydropyrimidinase |
| EC | 3.5.2.2 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 831093 |
| Trichome-related Gene from Literature | N/A |