| Detail of EST/Unigene CB893458 |
| Acc. | CB893458 |
| Internal Acc. | EST646250 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chaperonin CPN60-2, mitochondrial OS=Cucurbita maxima E-value=6e-20; Chaperonin CPN60-like 1, mitochondrial OS=Arabidopsis thaliana E-value=6e-20; Chaperonin CPN60, mitochondrial OS=Arabidopsis thaliana E-value=6e-20; Chaperonin CPN60-1, mitochondrial OS=Cucurbita maxima E-value=2e-19; Chaperonin CPN60, mitochondrial OS=Brassica napus E-value=2e-19; |
| Length | 152 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_HOGA; |
| Sequence | GGAGTCGAGGGTGCTGTTGTTGTTGGTAAACTTTTGGAACAGGATAATCCTGATCTTGGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 821983 |
| Trichome-related Gene from Literature | N/A |