| Detail of EST/Unigene CB893635 |
| Acc. | CB893635 |
| Internal Acc. | EST646427 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable serine/threonine-protein kinase Cx32, chloroplastic OS=Arabidopsis thaliana E-value=3e-07; Protein kinase 2A, chloroplastic OS=Arabidopsis thaliana E-value=4e-07; Protein kinase APK1B, chloroplastic OS=Arabidopsis thaliana E-value=1e-06; Protein kinase APK1A, chloroplastic OS=Arabidopsis thaliana E-value=2e-06; Protein kinase 2B, chloroplastic OS=Arabidopsis thaliana E-value=3e-06; |
| Length | 102 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_HOGA; |
| Sequence | TTTTGCTGAATTGAAGACAGCTACCAAGAATTTCACACTTGATAATCTCCTTGGAGAGGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | 1.A.2 Animal inward-rectifier K+ channel IRK-C; 1.A.26 Plant plasmodesmata PPD |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |