| Detail of EST/Unigene CB893839 |
| Acc. | CB893839 |
| Internal Acc. | EST646631 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Delta(8)-fatty-acid desaturase OS=Borago officinalis E-value=9e-85; Delta(8)-fatty-acid desaturase OS=Helianthus annuus E-value=2e-84; Fatty acid desaturase 1 OS=Rattus norvegicus E-value=2e-21; Fatty acid desaturase 2 OS=Rattus norvegicus E-value=2e-21; Fatty acid desaturase 2-like protein FADS2P1 OS=Mus musculus E-value=3e-21; |
| Length | 817 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_HOGA; |
| Sequence | TTGTATTTCAAAAACAACCATTAAAGGCGTTACCTTGTTTTGAGATTTTTTTTACATTGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K10224 fatty acid desaturase 1 (delta-5 desaturase); Metabolism > Lipid Metabolism > ko00592 alpha-Linolenic acid metabolism > K10226 fatty acid desaturase 2 (delta-6 desaturase); Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K10226 fatty acid desaturase 2 (delta-6 desaturase) |
| EC | 1.14.19.- |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 825331 |
| Trichome-related Gene from Literature | N/A |