Detail of EST/Unigene CB893945 |
Acc. | CB893945 |
Internal Acc. | EST646737 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Endo-1,3;1,4-beta-D-glucanase OS=Zea mays E-value=6e-27; Carboxymethylenebutenolidase homolog OS=Xenopus tropicalis E-value=3e-14; Carboxymethylenebutenolidase homolog OS=Xenopus laevis E-value=7e-14; Protein AIM2 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=8e-13; Carboxymethylenebutenolidase homolog OS=Mus musculus E-value=2e-11; |
Length | 753 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_HOGA; |
Sequence | TGGTCTTGATGCTTACCTCACTGGCTCTCCTCTTTCCACCAAAGCCATTCTCTTTGTTTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00627 1,4-Dichlorobenzene degradation > K01061 carboxymethylenebutenolidase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00364 Fluorobenzoate degradation > K01061 carboxymethylenebutenolidase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00361 gamma-Hexachlorocyclohexane degradation > K01061 carboxymethylenebutenolidase |
EC | 3.1.-.- 3.1.1.45 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 821939 |
Trichome-related Gene from Literature | N/A |