| Detail of EST/Unigene CB894091 |
| Acc. | CB894091 |
| Internal Acc. | EST646883 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 1-aminocyclopropane-1-carboxylate synthase 1 OS=Prunus mume E-value=2e-62; 1-aminocyclopropane-1-carboxylate synthase 2 OS=Solanum lycopersicum E-value=1e-60; 1-aminocyclopropane-1-carboxylate synthase OS=Nicotiana tabacum E-value=4e-57; 1-aminocyclopropane-1-carboxylate synthase (Fragment) OS=Vigna radiata var. radiata E-value=6e-56; 1-aminocyclopropane-1-carboxylate synthase 2 OS=Cucurbita pepo E-value=8e-56; |
| Length | 419 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_HOGA; |
| Sequence | AGAAATGCTGTGGCAAATTTCATGTCAAAAGTGAGAGGTGGTAGGGTAAGATTTGATCCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K00814 alanine transaminase; Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K00814 alanine transaminase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K00814 alanine transaminase |
| EC | 2.6.1.2 4.4.1.14 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 837082 |
| Trichome-related Gene from Literature | N/A |