Detail of EST/Unigene CB894091 |
Acc. | CB894091 |
Internal Acc. | EST646883 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 1-aminocyclopropane-1-carboxylate synthase 1 OS=Prunus mume E-value=2e-62; 1-aminocyclopropane-1-carboxylate synthase 2 OS=Solanum lycopersicum E-value=1e-60; 1-aminocyclopropane-1-carboxylate synthase OS=Nicotiana tabacum E-value=4e-57; 1-aminocyclopropane-1-carboxylate synthase (Fragment) OS=Vigna radiata var. radiata E-value=6e-56; 1-aminocyclopropane-1-carboxylate synthase 2 OS=Cucurbita pepo E-value=8e-56; |
Length | 419 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_HOGA; |
Sequence | AGAAATGCTGTGGCAAATTTCATGTCAAAAGTGAGAGGTGGTAGGGTAAGATTTGATCCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K00814 alanine transaminase; Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K00814 alanine transaminase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K00814 alanine transaminase |
EC | 2.6.1.2 4.4.1.14 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 837082 |
Trichome-related Gene from Literature | N/A |