Detail of EST/Unigene CB894187 |
Acc. | CB894187 |
Internal Acc. | EST646979 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Geraniol 8-hydroxylase OS=Catharanthus roseus E-value=2e-64; Cytochrome P450 76C4 OS=Arabidopsis thaliana E-value=8e-64; Geraniol 8-hydroxylase OS=Swertia mussotii E-value=4e-62; Cytochrome P450 76C2 OS=Arabidopsis thaliana E-value=7e-62; Cytochrome P450 76C1 OS=Arabidopsis thaliana E-value=7e-62; |
Length | 739 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_HOGA; |
Sequence | GTTCAAGATCCTCCAAAGTTGTTGAGGTTTGCAATGATGTGTTAGATTCACTTCTTAATA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07422 cytochrome P450, family 2, subfamily U |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 840264 |
Trichome-related Gene from Literature | N/A |