| Detail of EST/Unigene CB894303 |
| Acc. | CB894303 |
| Internal Acc. | EST647095 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Serine hydroxymethyltransferase 1 OS=Dictyostelium discoideum E-value=0; Serine hydroxymethyltransferase 2 OS=Dictyostelium discoideum E-value=0; Serine hydroxymethyltransferase, mitochondrial OS=Bos taurus E-value=5e-95; Serine hydroxymethyltransferase, mitochondrial OS=Pisum sativum E-value=2e-93; Serine hydroxymethyltransferase, cytosolic OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=2e-93; |
| Length | 888 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_HOGA; |
| Sequence | CGTGCTTAATCCTCATGATCGGATTATGGGATTGTTTCTTCCTTCAGGTGGACATCTGAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00680 Methane metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00670 One carbon pool by folate > K00600 glycine hydroxymethyltransferase |
| EC | 2.1.2.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827027 |
| Trichome-related Gene from Literature | N/A |