| Detail of EST/Unigene CB894306 |
| Acc. | CB894306 |
| Internal Acc. | EST647098 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutamate-1-semialdehyde 2,1-aminomutase, chloroplastic OS=Glycine max E-value=0; Glutamate-1-semialdehyde 2,1-aminomutase 2, chloroplastic OS=Arabidopsis thaliana E-value=0; Glutamate-1-semialdehyde 2,1-aminomutase, chloroplastic OS=Brassica napus E-value=0; Glutamate-1-semialdehyde 2,1-aminomutase, chloroplastic OS=Nicotiana tabacum E-value=0; Glutamate-1-semialdehyde 2,1-aminomutase, chloroplastic OS=Solanum lycopersicum E-value=0; |
| Length | 915 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_HOGA; |
| Sequence | CTGCTTCGGGTATTGCAGGGCTTACCCTTCTCAATTGCTTCTCTTCTTTTTCAGCGAGAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00330 Arginine and proline metabolism > K00819 ornithine--oxo-acid transaminase; Metabolism > Metabolism of Cofactors and Vitamins > ko00860 Porphyrin and chlorophyll metabolism > K01845 glutamate-1-semialdehyde 2,1-aminomutase |
| EC | 2.6.1.13 5.4.3.8 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824034 |
| Trichome-related Gene from Literature | N/A |