Detail of EST/Unigene CB894326 |
Acc. | CB894326 |
Internal Acc. | EST647118 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Mitogen-activated protein kinase 9 OS=Arabidopsis thaliana E-value=0; Mitogen-activated protein kinase 8 OS=Arabidopsis thaliana E-value=0; Mitogen-activated protein kinase 15 OS=Arabidopsis thaliana E-value=0; Mitogen-activated protein kinase 14 OS=Oryza sativa subsp. japonica E-value=0; Mitogen-activated protein kinase 15 OS=Oryza sativa subsp. japonica E-value=0; |
Length | 827 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_HOGA; |
Sequence | CCACCCGTATCCTAAGAGAAATCAAGCTCTTGCGCTTGCTCAGGCATCCTGATATTGTTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04150 mTOR signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04350 TGF-beta signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04464 mitogen-activated protein kinase 7; Environmental Information Processing > Signal Transduction > ko04011 MAPK signaling pathway - yeast > K04464 mitogen-activated protein kina |
EC | 2.7.1.- 2.7.11.24 |
Transcription Factor Family | WRKY |
Transporter Classification Family | 1.A.2 Animal inward-rectifier K+ channel IRK-C; 1.A.26 Plant plasmodesmata PPD |
Probeset |
|
Corresponding NCBI Gene | 821329 |
Trichome-related Gene from Literature | N/A |