Detail of EST/Unigene CB894360 |
Acc. | CB894360 |
Internal Acc. | EST647152 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Small heat shock protein, chloroplastic OS=Pisum sativum E-value=9e-95; Small heat shock protein, chloroplastic (Fragment) OS=Glycine max E-value=4e-78; Small heat shock protein, chloroplastic OS=Petunia hybrida E-value=1e-72; Small heat shock protein, chloroplastic OS=Solanum lycopersicum E-value=3e-70; 25.3 kDa heat shock protein, chloroplastic OS=Arabidopsis thaliana E-value=3e-66; |
Length | 774 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_HOGA; |
Sequence | CATTGTCAACAACTACTTCACCTATGCTTTCCCCAAAAGCAGGGTACTCGGCAGAAACAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828881 |
Trichome-related Gene from Literature | N/A |