Detail of EST/Unigene CB894364 |
Acc. | CB894364 |
Internal Acc. | EST647156 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 14 OS=Arabidopsis thaliana E-value=3e-33; Glucan endo-1,3-beta-glucosidase 12 OS=Arabidopsis thaliana E-value=1e-31; Glucan endo-1,3-beta-glucosidase 10 OS=Arabidopsis thaliana E-value=8e-31; Glucan endo-1,3-beta-glucosidase 11 OS=Arabidopsis thaliana E-value=1e-30; Glucan endo-1,3-beta-glucosidase 3 OS=Arabidopsis thaliana E-value=5e-29; |
Length | 814 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_HOGA; |
Sequence | TCAAAACAAAACGCAGAAACATAGTGAAGAGTGATAAGGTGTTTTGTGAGAAAAACCAAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817201 |
Trichome-related Gene from Literature | N/A |