Detail of EST/Unigene CB894432 |
Acc. | CB894432 |
Internal Acc. | EST647224 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cullin-1 OS=Arabidopsis thaliana E-value=0; Cullin-2 OS=Arabidopsis thaliana E-value=3e-70; Cullin-like protein 3 OS=Arabidopsis thaliana E-value=5e-61; Putative cullin-like protein 1 OS=Arabidopsis thaliana E-value=1e-38; Putative cullin-like protein 2 OS=Arabidopsis thaliana E-value=7e-36; |
Length | 722 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_HOGA; |
Sequence | TGAAAGGAAAACTATAGACCTAGAACAAGGATGGGATTTTATGCATAGGGGTATTATGAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K03869 cullin 3; Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K10609 cullin 4; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K10609 cullin 4 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825648 |
Trichome-related Gene from Literature | N/A |