Detail of EST/Unigene CB894470 |
Acc. | CB894470 |
Internal Acc. | EST647262 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Shaggy-related protein kinase eta OS=Arabidopsis thaliana E-value=0; Shaggy-related protein kinase zeta OS=Arabidopsis thaliana E-value=0; Shaggy-related protein kinase iota OS=Arabidopsis thaliana E-value=0; Shaggy-related protein kinase gamma OS=Arabidopsis thaliana E-value=0; Shaggy-related protein kinase NtK-1 OS=Nicotiana tabacum E-value=0; |
Length | 821 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_HOGA; |
Sequence | AGGCAGTAGCCATTAAGAAGGTTTTGCAAGACCGAAGATATAAGAACCGTGAACTACAAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K03083 glycogen synthase kinase 3 beta; Environmental Information Processing > Signal Transduction > ko04340 Hedgehog signaling pathway > K03083 glycogen synthase kinase 3 beta; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K03083 glycogen synthase kinase 3 beta |
EC | 2.7.11.26 |
Transcription Factor Family | WRKY |
Transporter Classification Family | 1.A.2 Animal inward-rectifier K+ channel IRK-C; 1.A.26 Plant plasmodesmata PPD |
Probeset |
|
Corresponding NCBI Gene | 827605 |
Trichome-related Gene from Literature | 827605 |