| Detail of EST/Unigene CB894540 |
| Acc. | CB894540 |
| Internal Acc. | EST647332 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Serine hydroxymethyltransferase 2 OS=Dictyostelium discoideum E-value=2e-27; Serine hydroxymethyltransferase 1 OS=Dictyostelium discoideum E-value=2e-25; Serine hydroxymethyltransferase, mitochondrial OS=Candida glabrata (strain ATCC 2001 / CBS 138 / JCM 3761 / NBRC 0622 / NRRL Y-65) E-value=9e-23; Serine hydroxymethyltransferase, mitochondrial OS=Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37) E-value=2e-22; Serine hydroxymethyltransferase, mitochondrial OS=Ashbya gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056) E-value=3e-22; |
| Length | 228 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_HOGA; |
| Sequence | AAGTTGATTATTTGTGGTGGAAGTGCTTATCCTAGAGATTGGGATTATGGAAGGTTTAGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00680 Methane metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00670 One carbon pool by folate > K00600 glycine hydroxymethyltransferase |
| EC | 2.1.2.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827027 |
| Trichome-related Gene from Literature | N/A |