Detail of EST/Unigene CB894693 |
Acc. | CB894693 |
Internal Acc. | EST647485 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Transketolase, chloroplastic (Fragment) OS=Craterostigma plantagineum E-value=6e-62; Transketolase, chloroplastic OS=Spinacia oleracea E-value=1e-60; Transketolase, chloroplastic OS=Zea mays E-value=3e-60; Transketolase, chloroplastic OS=Solanum tuberosum E-value=5e-59; Transketolase 7 OS=Craterostigma plantagineum E-value=5e-53; |
Length | 416 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_HOGA; |
Sequence | CATACAAAGTTGCAGTGCTTAACAGGAAGAGACCCTCTATCCTTGCCCTTTCTAGACAAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819137 |
Trichome-related Gene from Literature | N/A |