Detail of EST/Unigene CB894791 |
Acc. | CB894791 |
Internal Acc. | EST647583 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamine synthetase cytosolic isozyme OS=Medicago sativa E-value=4e-87; Glutamine synthetase nodule isozyme OS=Vigna aconitifolia E-value=1e-84; Glutamine synthetase cytosolic isozyme OS=Lotus japonicus E-value=1e-83; Glutamine synthetase OS=Nicotiana plumbaginifolia E-value=4e-83; Glutamine synthetase cytosolic isozyme 1 OS=Glycine max E-value=1e-82; |
Length | 498 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_HOGA; |
Sequence | GAAGGGAGCATATACCCACAAGCCAAGAGCAAGGATCCATTCAGAAGGGGCAACAATATC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Energy Metabolism > ko00910 Nitrogen metabolism > K01915 glutamine synthetase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01915 glutamine synthetase; Metabolism > Glycan Biosynthesis and Metabolism > ko00550 Peptidoglycan biosynthesis > K01915 glutamine synthetase; Environmental Information Processing > Signal Transduction > ko02020 Two-component system > K01915 glutamine synthetase |
EC | 6.3.1.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 833738 |
Trichome-related Gene from Literature | N/A |