Detail of EST/Unigene CB894893 |
Acc. | CB894893 |
Internal Acc. | EST647685 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamate-1-semialdehyde 2,1-aminomutase, chloroplastic OS=Glycine max E-value=0; Glutamate-1-semialdehyde 2,1-aminomutase 2, chloroplastic OS=Arabidopsis thaliana E-value=0; Glutamate-1-semialdehyde 2,1-aminomutase, chloroplastic OS=Nicotiana tabacum E-value=0; Glutamate-1-semialdehyde 2,1-aminomutase, chloroplastic OS=Solanum lycopersicum E-value=0; Glutamate-1-semialdehyde 2,1-aminomutase, chloroplastic OS=Brassica napus E-value=0; |
Length | 794 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_HOGA; |
Sequence | CGACCAGAAGCCCAGCACCGAAAAACTCACTCTCCGCAAATCTGAAGAAGCTTTCGCCGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00330 Arginine and proline metabolism > K00819 ornithine--oxo-acid transaminase; Metabolism > Metabolism of Cofactors and Vitamins > ko00860 Porphyrin and chlorophyll metabolism > K01845 glutamate-1-semialdehyde 2,1-aminomutase |
EC | 2.6.1.13 5.4.3.8 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824034 |
Trichome-related Gene from Literature | N/A |