| Detail of EST/Unigene CB894999 |
| Acc. | CB894999 |
| Internal Acc. | EST647791 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 25.3 kDa heat shock protein, chloroplastic OS=Arabidopsis thaliana E-value=3e-22; Small heat shock protein, chloroplastic OS=Petunia hybrida E-value=1e-21; Small heat shock protein, chloroplastic OS=Solanum lycopersicum E-value=1e-21; Small heat shock protein, chloroplastic (Fragment) OS=Glycine max E-value=4e-21; Small heat shock protein, chloroplastic OS=Pisum sativum E-value=7e-21; |
| Length | 736 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_HOGA; |
| Sequence | TTTCAAGATCAAACAACATTAAACACCATCAGTCCCAACCTAAGAAGAGAGTTTTTCCTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828881 |
| Trichome-related Gene from Literature | N/A |