| Detail of EST/Unigene CB895139 |
| Acc. | CB895139 |
| Internal Acc. | EST647931 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | O-succinylhomoserine sulfhydrylase OS=Pseudomonas aeruginosa (strain ATCC 15692 / PAO1 / 1C / PRS 101 / LMG 12228) E-value=1e-30; Methionine gamma-lyase OS=Pseudomonas putida E-value=2e-30; Cystathionine gamma-lyase OS=Bacillus subtilis (strain 168) E-value=5e-30; Cystathionine beta-lyase OS=Coxiella burnetii (strain RSA 493 / Nine Mile phase I) E-value=5e-28; Cystathionine beta-lyase OS=Lactococcus lactis subsp. cremoris E-value=1e-27; |
| Length | 806 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_HOGA; |
| Sequence | AACTCCCTTCTCCTACACACTAAACCCATGGCTGACACTTTCCTCATGACCACCACCACC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00910 Nitrogen metabolism > K01758 cystathionine gamma-lyase; Metabolism > Amino Acid Metabolism > ko00272 Cysteine metabolism > K01758 cystathionine gamma-lyase; Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K01758 cystathionine gamma-lyase; Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K01758 cystathionine gamma-lyase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01758 cystathionine gamma-lyase |
| EC | 4.4.1.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 842774 |
| Trichome-related Gene from Literature | N/A |