| Detail of EST/Unigene CF067991 |
| Acc. | CF067991 |
| Internal Acc. | EST668712 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Methionine aminopeptidase 1D, chloroplastic/mitochondrial OS=Arabidopsis thaliana E-value=1e-81; Methionine aminopeptidase 1B, chloroplastic OS=Arabidopsis thaliana E-value=3e-53; Methionine aminopeptidase 1C, chloroplastic/mitochondrial OS=Arabidopsis thaliana E-value=7e-49; Methionine aminopeptidase 1D, mitochondrial OS=Dictyostelium discoideum E-value=2e-46; Methionine aminopeptidase 1D, mitochondrial OS=Homo sapiens E-value=2e-41; |
| Length | 642 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTUS_MIXTISSUE; |
| Sequence | CTATGGCCGCAAGCAGCAGCGTGTCACTGTTGAAGTCTTCTTTCACCGGAGATCGATTCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 3.4.11.18 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829858 |
| Trichome-related Gene from Literature | N/A |