| Detail of EST/Unigene CF068125 |
| Acc. | CF068125 |
| Internal Acc. | EST668846 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | RING-box protein 1a OS=Arabidopsis thaliana E-value=3e-53; RING-box protein 1 OS=Salmo salar E-value=2e-51; E3 ubiquitin-protein ligase RBX1 OS=Mus musculus E-value=2e-51; E3 ubiquitin-protein ligase RBX1 OS=Homo sapiens E-value=2e-51; RING-box protein 1A OS=Drosophila melanogaster E-value=9e-51; |
| Length | 632 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTUS_MIXTISSUE; |
| Sequence | CGAAACTTCCTGCTGCGCTCACGGCGGTCCTTCTTCCAAGAAGCCGAAGCGCTTCGAGAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K03868 RING-box protein 1; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K03868 RING-box protein 1; Environmental Information Processing > Signal Transduction > ko04350 TGF-beta signaling pathway > K03868 RING-box protein 1; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K03868 RING-box protein 1 |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 823327 |
| Trichome-related Gene from Literature | N/A |