Detail of EST/Unigene CF068165 |
Acc. | CF068165 |
Internal Acc. | EST668886 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Putative WEB family protein At1g65010, chloroplastic OS=Arabidopsis thaliana E-value=2e-25; WEB family protein At3g02930, chloroplastic OS=Arabidopsis thaliana E-value=6e-25; WEB family protein At5g16730, chloroplastic OS=Arabidopsis thaliana E-value=5e-24; WEB family protein At4g27595, chloroplastic OS=Arabidopsis thaliana E-value=6e-22; Chromosome partition protein Smc OS=Aquifex aeolicus (strain VF5) E-value=3e-06; |
Length | 766 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTUS_MIXTISSUE; |
Sequence | ATCAAAGATTTAGAGGATAAGAAAGTAACTGAGAAAGAGTTGCCAAAGATCAAGGTAAAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830163 |
Trichome-related Gene from Literature | N/A |