| Detail of EST/Unigene CF068165 |
| Acc. | CF068165 |
| Internal Acc. | EST668886 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Putative WEB family protein At1g65010, chloroplastic OS=Arabidopsis thaliana E-value=2e-25; WEB family protein At3g02930, chloroplastic OS=Arabidopsis thaliana E-value=6e-25; WEB family protein At5g16730, chloroplastic OS=Arabidopsis thaliana E-value=5e-24; WEB family protein At4g27595, chloroplastic OS=Arabidopsis thaliana E-value=6e-22; Chromosome partition protein Smc OS=Aquifex aeolicus (strain VF5) E-value=3e-06; |
| Length | 766 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTUS_MIXTISSUE; |
| Sequence | ATCAAAGATTTAGAGGATAAGAAAGTAACTGAGAAAGAGTTGCCAAAGATCAAGGTAAAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 830163 |
| Trichome-related Gene from Literature | N/A |