| Detail of EST/Unigene CF068178 |
| Acc. | CF068178 |
| Internal Acc. | EST668899 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin-like 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-67; Thioredoxin-like 2-1, chloroplastic OS=Arabidopsis thaliana E-value=2e-55; Thioredoxin-like 2-2, chloroplastic OS=Arabidopsis thaliana E-value=1e-54; Thioredoxin-like 1-2, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-37; Thioredoxin-like 1-3, chloroplastic OS=Arabidopsis thaliana E-value=2e-34; |
| Length | 727 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTUS_MIXTISSUE; |
| Sequence | CTCTTTTGTGTAAGTGTAAATGGCACTACACATTCATAATACTATTCGATTACACTTTCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828722 |
| Trichome-related Gene from Literature | N/A |