Detail of EST/Unigene CF068178 |
Acc. | CF068178 |
Internal Acc. | EST668899 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin-like 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-67; Thioredoxin-like 2-1, chloroplastic OS=Arabidopsis thaliana E-value=2e-55; Thioredoxin-like 2-2, chloroplastic OS=Arabidopsis thaliana E-value=1e-54; Thioredoxin-like 1-2, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-37; Thioredoxin-like 1-3, chloroplastic OS=Arabidopsis thaliana E-value=2e-34; |
Length | 727 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTUS_MIXTISSUE; |
Sequence | CTCTTTTGTGTAAGTGTAAATGGCACTACACATTCATAATACTATTCGATTACACTTTCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828722 |
Trichome-related Gene from Literature | N/A |