Detail of EST/Unigene CF068544 |
Acc. | CF068544 |
Internal Acc. | EST669265 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Endo-1,3(4)-beta-glucanase 1 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=6e-14; Endo-1,3(4)-beta-glucanase 2 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=3e-11; Endo-1,3(4)-beta-glucanase 1 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=1e-10; Putative endo-1,3(4)-beta-glucanase 2 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=6e-10; |
Length | 743 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTUS_MIXTISSUE; |
Sequence | GATGATTTTAAGTATCAAAGCATTGATGGAGACCTTGTTGGTGTTGTTGGTGATTCATGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 838411 |
Trichome-related Gene from Literature | N/A |