| Detail of EST/Unigene CF068673 |
| Acc. | CF068673 |
| Internal Acc. | EST669394 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Translation initiation factor IF-1, chloroplastic OS=Glycine max E-value=1e-26; Translation initiation factor IF-1, chloroplastic OS=Buxus microphylla E-value=3e-21; Translation initiation factor IF-1, chloroplastic OS=Garrya elliptica E-value=5e-21; Translation initiation factor IF-1, chloroplastic OS=Cercidiphyllum japonicum E-value=5e-21; Translation initiation factor IF-1, chloroplastic OS=Nandina domestica E-value=7e-21; |
| Length | 482 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTUS_MIXTISSUE; |
| Sequence | AACACATCAAACTAACTTCAACCATAAACCTTCAATTCCTCTAAAAGCCATCATCATCAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 826719 |
| Trichome-related Gene from Literature | N/A |