Detail of EST/Unigene CF068673 |
Acc. | CF068673 |
Internal Acc. | EST669394 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Translation initiation factor IF-1, chloroplastic OS=Glycine max E-value=1e-26; Translation initiation factor IF-1, chloroplastic OS=Buxus microphylla E-value=3e-21; Translation initiation factor IF-1, chloroplastic OS=Garrya elliptica E-value=5e-21; Translation initiation factor IF-1, chloroplastic OS=Cercidiphyllum japonicum E-value=5e-21; Translation initiation factor IF-1, chloroplastic OS=Nandina domestica E-value=7e-21; |
Length | 482 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTUS_MIXTISSUE; |
Sequence | AACACATCAAACTAACTTCAACCATAAACCTTCAATTCCTCTAAAAGCCATCATCATCAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826719 |
Trichome-related Gene from Literature | N/A |