Detail of EST/Unigene CF069015 |
Acc. | CF069015 |
Internal Acc. | EST669736 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Phosphoglucan, water dikinase, chloroplastic OS=Arabidopsis thaliana E-value=8e-52; Phosphoglucan, water dikinase, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-47; Probable phosphoenolpyruvate synthase OS=Archaeoglobus fulgidus (strain ATCC 49558 / VC-16 / DSM 4304 / JCM 9628 / NBRC 100126) E-value=2e-06; Putative phosphoenolpyruvate synthase OS=Bacillus subtilis (strain 168) E-value=4e-06; |
Length | 680 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTUS_MIXTISSUE; |
Sequence | TTCTTTTAAAATTATTGATATCAAGACTTTATCCTCAGAGTTTTACTGAAATAATGTCTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 2.7.9.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 832706 |
Trichome-related Gene from Literature | N/A |