| Detail of EST/Unigene CF069015 |
| Acc. | CF069015 |
| Internal Acc. | EST669736 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Phosphoglucan, water dikinase, chloroplastic OS=Arabidopsis thaliana E-value=8e-52; Phosphoglucan, water dikinase, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-47; Probable phosphoenolpyruvate synthase OS=Archaeoglobus fulgidus (strain ATCC 49558 / VC-16 / DSM 4304 / JCM 9628 / NBRC 100126) E-value=2e-06; Putative phosphoenolpyruvate synthase OS=Bacillus subtilis (strain 168) E-value=4e-06; |
| Length | 680 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTUS_MIXTISSUE; |
| Sequence | TTCTTTTAAAATTATTGATATCAAGACTTTATCCTCAGAGTTTTACTGAAATAATGTCTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 2.7.9.2 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 832706 |
| Trichome-related Gene from Literature | N/A |