| Detail of EST/Unigene CF069174 |
| Acc. | CF069174 |
| Internal Acc. | EST669895 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Porphobilinogen deaminase, chloroplastic OS=Pisum sativum E-value=2e-20; Porphobilinogen deaminase, chloroplastic OS=Arabidopsis thaliana E-value=6e-20; Porphobilinogen deaminase, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-18; Porphobilinogen deaminase OS=Nitrobacter hamburgensis (strain X14 / DSM 10229) E-value=4e-11; Porphobilinogen deaminase OS=Nitrobacter winogradskyi (strain Nb-255 / ATCC 25391) E-value=7e-10; |
| Length | 189 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTUS_MIXTISSUE; |
| Sequence | ACTCAATGAAAGACGTTCCTACCTATTTGCCCGAGAAAACAATTTTGCCATGTAACCTTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 2.5.1.61 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 830724 |
| Trichome-related Gene from Literature | N/A |