Detail of EST/Unigene CF069174 |
Acc. | CF069174 |
Internal Acc. | EST669895 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Porphobilinogen deaminase, chloroplastic OS=Pisum sativum E-value=2e-20; Porphobilinogen deaminase, chloroplastic OS=Arabidopsis thaliana E-value=6e-20; Porphobilinogen deaminase, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-18; Porphobilinogen deaminase OS=Nitrobacter hamburgensis (strain X14 / DSM 10229) E-value=4e-11; Porphobilinogen deaminase OS=Nitrobacter winogradskyi (strain Nb-255 / ATCC 25391) E-value=7e-10; |
Length | 189 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTUS_MIXTISSUE; |
Sequence | ACTCAATGAAAGACGTTCCTACCTATTTGCCCGAGAAAACAATTTTGCCATGTAACCTTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 2.5.1.61 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830724 |
Trichome-related Gene from Literature | N/A |