| Detail of EST/Unigene CF069490 |
| Acc. | CF069490 |
| Internal Acc. | EST670211 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | CRS2-associated factor 2, mitochondrial OS=Arabidopsis thaliana E-value=1e-93; CRS2-associated factor 2, mitochondrial OS=Oryza sativa subsp. japonica E-value=5e-91; CRS2-associated factor 1, mitochondrial OS=Oryza sativa subsp. japonica E-value=3e-66; CRS2-associated factor 1, mitochondrial OS=Arabidopsis thaliana E-value=1e-60; CRS2-associated factor 2, chloroplastic OS=Arabidopsis thaliana E-value=3e-46; |
| Length | 712 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTUS_MIXTISSUE; |
| Sequence | AATTCAAACAAGACCCACCAAATCTACCTCTCAAATCGGACCTTCCATTCAACTTCATGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 835580 |
| Trichome-related Gene from Literature | N/A |