| Detail of EST/Unigene CF069734 |
| Acc. | CF069734 |
| Internal Acc. | EST670455 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ubiquinone biosynthesis protein COQ9, mitochondrial OS=Drosophila melanogaster E-value=3e-16; Ubiquinone biosynthesis protein COQ9, mitochondrial OS=Xenopus tropicalis E-value=2e-12; Ubiquinone biosynthesis protein COQ9, mitochondrial OS=Rattus norvegicus E-value=1e-11; Ubiquinone biosynthesis protein COQ9, mitochondrial OS=Mus musculus E-value=1e-11; Ubiquinone biosynthesis protein COQ9-A, mitochondrial OS=Xenopus laevis E-value=2e-11; |
| Length | 759 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTUS_MIXTISSUE; |
| Sequence | GTTCAACGGAAACGCTGCACTCCGGTTCCGGCGTCATAATGCATTGATAACTTATTCTCG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 838497 |
| Trichome-related Gene from Literature | N/A |