| Detail of EST/Unigene CF069867 |
| Acc. | CF069867 |
| Internal Acc. | EST670588 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Neurolysin, mitochondrial OS=Oryctolagus cuniculus E-value=4e-41; Thimet oligopeptidase OS=Bos taurus E-value=7e-41; Neurolysin, mitochondrial OS=Sus scrofa E-value=1e-40; Neurolysin, mitochondrial OS=Mus musculus E-value=2e-40; Neurolysin, mitochondrial OS=Bos taurus E-value=5e-40; |
| Length | 763 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTUS_MIXTISSUE; |
| Sequence | TACAAAAGAACTTGATGTCTTGAAAGATTTGAAGAAGAAAGAGGAAGGGGAGTTTCCATT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 3.4.24.16 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 843094 |
| Trichome-related Gene from Literature | N/A |