Detail of EST/Unigene CF069867 |
Acc. | CF069867 |
Internal Acc. | EST670588 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Neurolysin, mitochondrial OS=Oryctolagus cuniculus E-value=4e-41; Thimet oligopeptidase OS=Bos taurus E-value=7e-41; Neurolysin, mitochondrial OS=Sus scrofa E-value=1e-40; Neurolysin, mitochondrial OS=Mus musculus E-value=2e-40; Neurolysin, mitochondrial OS=Bos taurus E-value=5e-40; |
Length | 763 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTUS_MIXTISSUE; |
Sequence | TACAAAAGAACTTGATGTCTTGAAAGATTTGAAGAAGAAAGAGGAAGGGGAGTTTCCATT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 3.4.24.16 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 843094 |
Trichome-related Gene from Literature | N/A |