Detail of EST/Unigene CK293008 |
Acc. | CK293008 |
Internal Acc. | EST755722 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Flavonoid 3'-monooxygenase OS=Petunia hybrida E-value=1e-97; Flavonoid 3'-monooxygenase OS=Arabidopsis thaliana E-value=7e-79; Flavonoid 3',5'-hydroxylase 1 OS=Petunia hybrida E-value=7e-60; Flavonoid 3',5'-hydroxylase 2 OS=Petunia hybrida E-value=6e-59; Flavonoid 3',5'-hydroxylase OS=Eustoma exaltatum subsp. russellianum E-value=1e-58; |
Length | 755 nt |
Species | Nicotiana benthamiana |
Belonged EST Libraries | NB_MTISSUE (1 ESTs); |
Sequence | AAAGATTTAGCTATATAATGCCAATTATTTGGACTATCGTTGCCAATACTAATATAAGGC |
EST members of Unigene | CK293008 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1 |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830693 |
Trichome-related Gene from Literature | 830693 |