Detail of EST/Unigene CK295666 |
Acc. | CK295666 |
Internal Acc. | EST758380 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Probable 1-deoxy-D-xylulose-5-phosphate synthase, chloroplastic OS=Capsicum annuum E-value=0; 1-deoxy-D-xylulose-5-phosphate synthase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=0; 1-deoxy-D-xylulose-5-phosphate synthase, chloroplastic OS=Arabidopsis thaliana E-value=0; Probable 1-deoxy-D-xylulose-5-phosphate synthase 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=0; 1-deoxy-D-xylulose-5-phosphate synthase OS=Rhizobium loti (strain MAFF303099) E-value=1e-79; |
Length | 871 nt |
Species | Nicotiana benthamiana |
Belonged EST Libraries | NB_MTISSUE (1 ESTs); |
Sequence | AATCATAGGTCTTATAGAAGACACTTTACATATTTCAAACTTGTTTATGGTAGTTATATC |
EST members of Unigene | CK295666 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00030 Pentose phosphate pathway > K00615 transketolase; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K00615 transketolase; Metabolism > Biosynthesis of Polyketides and Nonribosomal Peptides > ko01051 Biosynthesis of ansamycins > K00615 transketolase |
EC | 2.2.1.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827230 |
Trichome-related Gene from Literature | 827230 |