Detail of EST/Unigene CN655530 |
Acc. | CN655530 |
Internal Acc. | SAL_US005xl18f1.ab1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=6e-73; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=7e-72; Chlorophyll a-b binding protein 7, chloroplastic OS=Nicotiana tabacum E-value=7e-71; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=2e-70; Chlorophyll a-b binding protein E, chloroplastic OS=Nicotiana plumbaginifolia E-value=2e-70; |
Length | 528 nt |
Species | Nicotiana benthamiana |
Belonged EST Libraries | NB_SAL_US; |
Sequence | CAAACCAGCAACTACTAGCTTTTTTCTTGATAAACCAGGCAGCTGCTACAAGGCTCTTTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839870 |
Trichome-related Gene from Literature | 839870 |