Detail of EST/Unigene CN741574 |
Acc. | CN741574 |
Internal Acc. | SAL_US006xa21f1.ab1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=8e-59; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=1e-58; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=2e-58; Chlorophyll a-b binding protein 1D (Fragment) OS=Solanum lycopersicum E-value=2e-58; Chlorophyll a-b binding protein 22R, chloroplastic OS=Petunia sp. E-value=2e-58; |
Length | 511 nt |
Species | Nicotiana benthamiana |
Belonged EST Libraries | NB_SAL_US; |
Sequence | GCATCTTGGCCATTTGGGCTTGTCAAGTTGTGTTGATGGGAGCCGTTGAGGGTTACCGTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 822391 |
Trichome-related Gene from Literature | N/A |