Detail of EST/Unigene CN743997 |
Acc. | CN743997 |
Internal Acc. | SAL_US009xm20f1.ab1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein, chloroplastic OS=Spinacia oleracea E-value=7e-53; Chlorophyll a-b binding protein 91R, chloroplastic OS=Petunia sp. E-value=7e-53; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=9e-53; Chlorophyll a-b binding protein 25, chloroplastic OS=Petunia sp. E-value=9e-53; Chlorophyll a-b binding protein 1, chloroplastic OS=Zea mays E-value=1e-52; |
Length | 437 nt |
Species | Nicotiana benthamiana |
Belonged EST Libraries | NB_SAL_US; |
Sequence | TTTTGGCCCGTATGGCGTCAATTTGGTGAGGCTGTGTGGTTCAGGCTGGATCACAAATCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 822391 |
Trichome-related Gene from Literature | N/A |