Detail of EST/Unigene CN745309 |
Acc. | CN745309 |
Internal Acc. | SAL_US009xi05f1.ab1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=2e-26; Chlorophyll a-b binding protein E, chloroplastic OS=Nicotiana plumbaginifolia E-value=4e-26; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=1e-25; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=2e-25; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=2e-25; |
Length | 297 nt |
Species | Nicotiana benthamiana |
Belonged EST Libraries | NB_SAL_US; |
Sequence | GGAAAAACACTTATTTCTCCTTATTAAACCTGGCTGCTTCTACAATGGCTCTCTCTTCCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839870 |
Trichome-related Gene from Literature | 839870 |