Detail of EST/Unigene CN745474 |
Acc. | CN745474 |
Internal Acc. | SAL_US003xe20r1.ab1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein AB10, chloroplastic OS=Malus domestica E-value=1e-53; Chlorophyll a-b binding protein 13, chloroplastic OS=Solanum lycopersicum E-value=1e-49; Chlorophyll a-b binding protein of LHCII type III, chloroplastic OS=Hordeum vulgare E-value=1e-48; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=2e-47; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=2e-47; |
Length | 612 nt |
Species | Nicotiana benthamiana |
Belonged EST Libraries | NB_SAL_US; |
Sequence | CTGAAGTATTGACACTATTCTTCATTAATCCAAACCAATTTACATCACATACCAATCCCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835515 |
Trichome-related Gene from Literature | N/A |